x402 census · bio.halowerk.com · 128d4ac6c14b · JSON
POST /v1/phage-matching
unprobed
Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.
Verdict: not verified by an unpaid GET. not probed yet. This says nothing about whether the route works when called as declared.
Facts from the catalogs
| Field | Value |
|---|---|
| URL | https://bio.halowerk.com/v1/phage-matching |
| Method | POST |
| Price | $0.004 USDC = 4000 atomic units of 0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913 |
| Network | eip155:8453 (base) |
| payTo | 0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E |
| Seller | bio.halowerk.com |
| Catalogs | cdp (row updated 2026-09-01) |
| Listed since (lower bound) | 2026-09-01 (earliest catalog timestamp; catalogs report last-update times only) |
| Last catalog update | 2026-09-01 |
| CDP quality counters | 1 calls and 1 unique payers in 30 days, last call 2026-09-01 (catalog-reported, not verified on chain) |
| Category (keyword rule) | other/unknown |
| Templated path | no |
| x402Version in catalog | 2 |
| Service name / tags | none |
Unpaid probe (census of )
| Field | Value |
|---|---|
| Probe | not probed in this build |
No hourly re-probe has reached this resource yet; the cron covers a rotating slice of 150 per hour.
On-chain facts for the payTo (public address)
| Field | Value |
|---|---|
| Distinct payers | 13 |
| Payments | 94 |
| USDC volume | $0.33 |
| Median payment | $0.003 |
| First / last payment | 2026-08-10 / 2026-09-30 |
| Sampler-shaped share of payments | 98.9% |
| Payers that are not samplers | 1 |
| Source | forensics-2026-09-30 |
| Address | 0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E (contract: EIP7702StatelessDeleGator) |
Declared input and output (extensions.bazaar)
{
"input": {
"body": {
"max_mismatches": 2,
"phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
"spacers": [
{
"id": "spacer-1",
"sequence": "GGCTAACCGTTCGATC"
},
{
"id": "spacer-2",
"sequence": "ATGCCTGAATTCGGCA"
}
]
},
"bodyType": "json",
"method": "POST",
"type": "http"
}
}
Try it (unpaid: shows the 402)
curl -si -X POST 'https://bio.halowerk.com/v1/phage-matching' -H 'accept: application/json' -H 'content-type: application/json' --data '{}'
The catalog declares POST. A 402 answer carries the payment requirements in the JSON body and, for x402 v2, base64 in the PAYMENT-REQUIRED header. This page never sends a payment.
Paid checks (x402, USDC on Base)
GET https://bazaar.agentexchange.work/r/128d4ac6c14b/probe.json re-runs this probe right now for $0.01 and writes the result here. POST https://bazaar.agentexchange.work/featured with {"id":"128d4ac6c14b"} places this resource at the top of the report and search pages for 30 days for $1.00, labelled. Unpaid requests answer 402 with the terms. Pricing.
Catalog references: agentic.market (CDP Bazaar front end) · this record as JSON · all resources on bio.halowerk.com.