x402 census · bio.halowerk.com · 1b5177c14ef7 · JSON
POST /v1/crispr-offtarget
live
Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.
Verdict: live. The unpaid GET reached a valid 402 (confirmed by the re-probe of 2026-10-02).
Facts from the catalogs
| Field | Value |
|---|---|
| URL | https://bio.halowerk.com/v1/crispr-offtarget |
| Method | POST |
| Price | $0.004 USDC = 4000 atomic units of 0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913 |
| Network | eip155:8453 (base) |
| payTo | 0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E |
| Seller | bio.halowerk.com |
| Catalogs | cdp (row updated 2026-09-20) |
| Listed since (lower bound) | 2026-09-20 (earliest catalog timestamp; catalogs report last-update times only) |
| Last catalog update | 2026-09-20 |
| CDP quality counters | 2 calls and 2 unique payers in 30 days, last call 2026-09-20 (catalog-reported, not verified on chain) |
| Category (keyword rule) | other/unknown |
| Templated path | no |
| x402Version in catalog | 2 |
| Service name / tags | none |
Unpaid probe (census of )
| Field | Value |
|---|---|
| Probe | not probed in this build |
Latest re-probe
| Field | Value |
|---|---|
| Re-probed at | 2026-10-02T09:13:42.000Z (cron) |
| Verdict now | live changed from unprobed |
| HEAD / GET | 402 / 402 |
| accepts[0] | {"scheme":"exact","network":"eip155:8453","amount":"4000","payTo":"0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E","asset":"0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913","maxTimeoutSeconds":300,"extra":{"name":"USD Coin","version":"2"}} |
| Live amount equals catalog price | yes |
| Latency | 1,729 ms |
| Error | none |
On-chain facts for the payTo (public address)
| Field | Value |
|---|---|
| Distinct payers | 13 |
| Payments | 94 |
| USDC volume | $0.33 |
| Median payment | $0.003 |
| First / last payment | 2026-08-10 / 2026-09-30 |
| Sampler-shaped share of payments | 98.9% |
| Payers that are not samplers | 1 |
| Source | forensics-2026-09-30 |
| Address | 0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E (contract: EIP7702StatelessDeleGator) |
Declared input and output (extensions.bazaar)
{
"input": {
"body": {
"candidates": [
{
"id": "candidate-1",
"pam": "AGG",
"protospacer": "GAGTCCGAGCAGAAGAAGAA"
},
{
"id": "candidate-2",
"pam": "TGG",
"protospacer": "GAGTCCGAGCAGAAGATGAA"
},
{
"id": "candidate-3",
"pam": "TGA",
"protospacer": "GACTCCGAGCAGAAGAAGAT"
}
],
"guide": "GAGTCCGAGCAGAAGAAGAA"
},
"bodyType": "json",
"method": "POST",
"type": "http"
}
}
Try it (unpaid: shows the 402)
curl -si -X POST 'https://bio.halowerk.com/v1/crispr-offtarget' -H 'accept: application/json' -H 'content-type: application/json' --data '{}'
The catalog declares POST. A 402 answer carries the payment requirements in the JSON body and, for x402 v2, base64 in the PAYMENT-REQUIRED header. This page never sends a payment.
Paid checks (x402, USDC on Base)
GET https://bazaar.agentexchange.work/r/1b5177c14ef7/probe.json re-runs this probe right now for $0.01 and writes the result here. POST https://bazaar.agentexchange.work/featured with {"id":"1b5177c14ef7"} places this resource at the top of the report and search pages for 30 days for $1.00, labelled. Unpaid requests answer 402 with the terms. Pricing.
Catalog references: agentic.market (CDP Bazaar front end) · this record as JSON · all resources on bio.halowerk.com.